Stem-loop sequence mdm-MIR169n

AccessionMI0035670 (change log)
DescriptionMalus domestica miR169n stem-loop
Literature search

4 open access papers mention mdm-MIR169n
(9 sentences)

Stem-loop
   -ua   g   ag      aa     ua       au        g       -          u    u     -ca   uccca    cc  cg   aauuuaugug    - ug  aga  u   u              g 
5'    acu aug  ggaaga  ggucc  caugagg  gaagagcc uguuuug uagccaagga gacu gccug   acc     aagg  uc  aaa          uacu g  ag   ua gcu gguuagcuuagcua u
      ||| |||  ||||||  |||||  |||||||  |||||||| ||||||| |||||||||| |||| |||||   |||     ||||  ||  |||          |||| |  ||   || ||| ||||||||||||||  
3'    ugg uac  ucuucu  ccggg  guacucu  uuucuugg acagagc aucgguuccu cuga cggac   ugg     uucc  ag  uuu          guga c  uu   au cga ucgaucgaaucgau g
   cuc   g   cu      --     uc       cu        -       u          -    -     aua   -ucug    ua  aa   ---------g    u gu  --g  -   -              u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003479.331: 24710-24974 [-]
intergenic
Database links

Mature sequence mdm-miR169n

Accession MIMAT0043619
Sequence

52 - 

uagccaaggaugacuugccug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).