Stem-loop sequence mdm-MIR169m

AccessionMI0035669 (change log)
DescriptionMalus domestica miR169m stem-loop
Literature search

4 open access papers mention mdm-MIR169m
(9 sentences)

Stem-loop
   agag   u     ga     -     u         -uu       u   -ugg      a     a        cucuaccuagagagacgaacuccacu 
5'     aag gaaga  agaga ggucu gcaugagag   agagccu guu    uagcca ggaug cuugccug                          u
       ||| |||||  ||||| ||||| |||||||||   ||||||| |||    |||||| ||||| ||||||||                          g
3'     uuc cuucu  ucucu ccgga cguacucuu   ucucgga cag    aucggu ccuac ggacggac                          u
   cgag   -     --     u     c         ucu       -   uuua      c     -        cgguuuguccucaaaaggaguauguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC013245.290: 4504-4700 [+]
intergenic
Database links

Mature sequence mdm-miR169m

Accession MIMAT0043618
Sequence

52 - 

uagccaaggaugacuugccug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).