Stem-loop sequence mdm-MIR169l

AccessionMI0035668 (change log)
DescriptionMalus domestica miR169l stem-loop
Literature search

4 open access papers mention mdm-MIR169l
(9 sentences)

Stem-loop
   au  -  g   ag      aa     u        au        gu     -          u    u     cagccucccaaaggccucugcaacauauauauacaggcagagcucgcuagguagcuugcuagggauagcuagg 
5'   ga cu aug  ggaaga  ggucc gcaugagg  aaagagcc  ucuug uagccaagga gacu gccug                                                                         g
     || || |||  ||||||  ||||| ||||||||  ||||||||  ||||| |||||||||| |||| |||||                                                                         u
3'   cu gg uac  ucuucu  ccagg cguacucu  uuucuugg  agagc aucgguuccu cuga cggac                                                                         u
   -u  a  g   cu      --     u        cu        ac     u          -    -     auaugguguguuccuaagaauuaauuuggaauccuucaaucgaucgaaucgauugguucgugguccuaagaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011475.284: 254-543 [+]
intergenic
Database links

Mature sequence mdm-miR169l

Accession MIMAT0043617
Sequence

52 - 

uagccaaggaugacuugccug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).