Stem-loop sequence mdm-MIR171q

AccessionMI0035657 (change log)
DescriptionMalus domestica miR171q stem-loop
Literature search

9 open access papers mention mdm-MIR171q
(40 sentences)

Stem-loop
   --agaaaga     auu    u    uuga   g        uc         a     a a u    ucaa 
5'          gaugg   ggga cagu    acg gauauugg  cgguucaau agaaa c g gcuc    a
            |||||   |||| ||||    ||| ||||||||  ||||||||| ||||| | | ||||    g
3'          cuauu   uccu guca    ugc cuauaacc  gccgaguua uuuuu g c cgag    u
   cccuauaua     --c    u    -cug   a        gu         g     c g u    uucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC008623.473: 2694-2835 [+]
intergenic
Database links

Mature sequence mdm-miR171q

Accession MIMAT0043605
Sequence

32 - 

ggauauugguccgguucaaua

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).