Stem-loop sequence mdm-MIR319h

AccessionMI0035648 (change log)
DescriptionMalus domestica miR319h stem-loop
Literature search

4 open access papers mention mdm-MIR319h
(7 sentences)

Stem-loop
   a    u a          u           uc u       uuaag   ug  -a   a   g   ac       u   a   cu      aca   g 
5'  uaua g aaggagcucu cuucaguccag  c uggcagu     ggc  gc  cuc gcu cug  ucguugg uca aaa  caucau   uuu c
    |||| | |||||||||| |||||||||||  | |||||||     |||  ||  ||| ||| |||  ||||||| ||| |||  ||||||   |||  
3'  auau c uuccucgagg gaagucagguu  g acugucg     uug  ug  gag cga gac  agcaacc agu uuu  guggug   aaa u
   -    c a          -           cu c       --uua   gu  ga   c   g   ga       u   c   uu      aag   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC004434.326: 8757-8949 [+]
intergenic
Database links

Mature sequence mdm-miR319h

Accession MIMAT0043595
Sequence

12 - 

gagcucuucuucaguccagucc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).