Stem-loop sequence mdm-MIR395k

AccessionMI0035639 (change log)
DescriptionMalus domestica miR395k stem-loop
Literature search

5 open access papers mention mdm-MIR395k
(49 sentences)

Stem-loop
   gagaaaaaauuaac          cu u  a                -  u    aauuaaugu    uccuaauuaauucauu 
5'               aucagauggc  c ag guuuccucaaacacuu ca uaga         agag                c
                 ||||||||||  | || |||||||||||||||| || ||||         ||||                 
3'               uaguuuacug  g uc caaggggguuugugaa gu aucu         ucuc                u
   -ccaaauauauacc          ag u  c                a  c    cucucucuc    ucucucucucucucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 8270-8437 [-]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395k
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395kMDC003846.250: 8270-8437 [-]
mdm-MIR395eMDC003846.250: 1344-1471 [-]
Database links

Mature sequence mdm-miR395k

Accession MIMAT0043586
Sequence

32 - 

guuuccucaaacacuucauu

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).