Stem-loop sequence mdm-MIR393g

AccessionMI0035636 (change log)
DescriptionMalus domestica miR393g stem-loop
Literature search

6 open access papers mention mdm-MIR393g
(31 sentences)

Stem-loop
   uauauu  aa          c            c    u     c      - uauuuc 
5'       gc  cuagaggagg auccaaagggau gcau gaucc agcuag c      u
         ||  |||||||||| |||||||||||| |||| ||||| |||||| |       
3'       cg  gguuuccucu uagguuucccua cgua cuagg uugguu g      u
   -aacuu  aa          u            u    -     u      u cuaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC012340.117: 7899-8015 [+]
intergenic
Database links

Mature sequence mdm-miR393g

Accession MIMAT0043583
Sequence

78 - 

aucaugcuaucccuuuggauu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).