Stem-loop sequence mdm-MIR171p

AccessionMI0035635 (change log)
DescriptionMalus domestica miR171p stem-loop
Literature search

9 open access papers mention mdm-MIR171p
(40 sentences)

Stem-loop
   ------uuuu           u  ug  uacau  caa             c       u   -  cg       uauc g 
5'           gauggagaaag ug  aa     ag   agguauuggcgcg cucaauu gaa cg  uggcuaa    g a
             ||||||||||| ||  ||     ||   ||||||||||||| ||||||| ||| ||  |||||||    |  
3'           cuaccucuuuc ac  uu     uc   ucuauaacugcgc gaguuaa cuu gc  accgauu    c g
   acuucccuac           u  gu  -----  --c             c       u   a  au       ---- a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC015454.116: 3728-3873 [+]
intergenic
Database links

Mature sequence mdm-miR171p

Accession MIMAT0043582
Sequence

97 - 

uugagccgcgucaauaucucc

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).