Stem-loop sequence mdm-MIR169j

AccessionMI0035631 (change log)
DescriptionMalus domestica miR169j stem-loop
Literature search

4 open access papers mention mdm-MIR169j
(9 sentences)

Stem-loop
   uauucuacuua      ----   --uu     u       u     u gg  c      ugc    c     ag             -    aaugcucccauacaauauuuguauaucaacccuaaucuuguagaucuauauauguauauauguauaugugcauagcauau 
5'            uguggu    auu    ucauc uaagucu gcaug g  aa gaggua   agug agcca  gaugacuugccgg caac                                                                                a
              ||||||    |||    ||||| ||||||| ||||| |  || ||||||   |||| |||||  ||||||||||||| ||||                                                                                 
3'            gcacca    uag    aguag guuuaga cguac c  uu cuccgu   uuac ucggu  cugcugaacggcu guug                                                                                c
   --------cua      acaa   cagc     u       u     u uu  u      -uu    a     cu             a    agucacagkguucuaguacauagaauaguuaguacguauaugcguacucuacuguaguuguauguacuauguaggguaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC017225.184: 8894-9225 [+]
intergenic
Database links

Mature sequence mdm-miR169j

Accession MIMAT0043578
Sequence

62 - 

cagccaaggaugacuugccgg

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).