Stem-loop sequence mdm-MIR169g

AccessionMI0035628 (change log)
DescriptionMalus domestica miR169g stem-loop
Literature search

4 open access papers mention mdm-MIR169g
(9 sentences)

Stem-loop
   cugaagucuu     c            aua      gcugc     a   ug         -  gca   -------   uu u   -        guuauuuacagguauauaauauguucaucaaauaaaauuggcucuuagggguaaaacguacguuaaagaaa 
5'           gcaug aaacaugagaua   augugu     agcca gga  acuugccgg aa   acc       aac  c ccu cuucuucu                                                                       a
             ||||| ||||||||||||   ||||||     ||||| |||  ||||||||| ||   |||       |||  | ||| ||||||||                                                                       u
3'           uguac uuuguacucugu   uguaca     ucggu ccu  ugaacggcc uu   ugg       uug  g gga gaagaagg                                                                       u
   ---------u     a            --c      -----     c   gu         a  -ag   acagcuu   -u u   u        auuuacggugauuaggugcuacaauugcgaccgcaaccaucgauuuguuuagcauuggauacuagacuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011517.596: 5517-5828 [+]
intergenic
Database links

Mature sequence mdm-miR169g

Accession MIMAT0043575
Sequence

42 - 

cagccaaggaugacuugccgg

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).