Stem-loop sequence mdm-MIR395j

AccessionMI0035627 (change log)
DescriptionMalus domestica miR395j stem-loop
Literature search

5 open access papers mention mdm-MIR395j
(49 sentences)

Stem-loop
   aauuag         c  a      c  ug c      auu    -----aa    cg 
5'       cagguguca ca gaguuc cu  a cacuuc   ggga       uugc  u
         ||||||||| || |||||| ||  | ||||||   ||||       ||||  u
3'       guuuacggu gu cucaag gg  u gugaag   uccu       aacg  u
   -uuuua         u  c      a  gu u      gcg    auauauc    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC003846.250: 12355-12467 [+]
intergenic
Clustered miRNAs
< 10kb from mdm-MIR395j
mdm-MIR395kMDC003846.250: 8270-8437 [-]
mdm-MIR395gMDC003846.250: 11880-12031 [+]
mdm-MIR395hMDC003846.250: 12137-12240 [+]
mdm-MIR395jMDC003846.250: 12355-12467 [+]
mdm-MIR395dMDC003846.250: 17630-17771 [-]
mdm-MIR395bMDC003846.250: 18712-18848 [+]
Database links

Mature sequence mdm-miR395j

Accession MIMAT0043574
Sequence

22 - 

guucccuugaccacuucauug

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).