Stem-loop sequence mdm-MIR319g

AccessionMI0035623 (change log)
DescriptionMalus domestica miR319g stem-loop
Literature search

4 open access papers mention mdm-MIR319g
(7 sentences)

Stem-loop
   -----uaauaguuu        c  u    auu     ---   c        uauguguu uu   -      uu   u     uu          cu      ag  c       uu  a   g  g   ac        u  aa u         agga 
5'               ucauggag ag aaau   guugg   aau auguguau        c  aga gauggu  aag gagcu  cuucagucca  cacgga  gg aaagggu  ga uua cu ccg  ucauucau ca  c caguagaaa    g
                 |||||||| || ||||   |||||   ||| ||||||||        |  ||| ||||||  ||| |||||  ||||||||||  ||||||  || |||||||  || ||| || |||  |||||||| ||  | |||||||||    u
3'               aguacuuu uc uuua   caauc   uug uacauaug        g  ucu cuauca  uuc cucga  gaagucaggu  gugucu  uc uuucuua  uu aau ga ggc  aguaagug gu  g gucaucuuu    g
   cuagugauuuaugu        -  -    --c     cau   u        ------uu uu   u      uu   c     gg          uc      cu  u       cu  a   a  g   gu        u  aa c         auag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011566.500: 5042-5349 [-]
intergenic
Database links

Mature sequence mdm-miR319g

Accession MIMAT0043569
Sequence

72 - 

gagcuuucuucaguccacuc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).