Stem-loop sequence mdm-MIR319e

AccessionMI0035621 (change log)
DescriptionMalus domestica miR319e stem-loop
Literature search

4 open access papers mention mdm-MIR319e
(7 sentences)

Stem-loop
   aucuua        uu    u     uu          cu      ag  c      uu    -   g  g   ac        u  aa u           ga 
5'       gagauagu  gaag gagcu  cuucagucca  caugga  gg aaaggg  ugaa uua cu ccg  ucauucau ca  c caguagaaaug  g
         ||||||||  |||| |||||  ||||||||||  ||||||  || ||||||  |||| ||| || |||  |||||||| ||  | |||||||||||  u
3'       uucuguca  uuuc cucga  gaagucaggu  gugucu  uc uuuucu  acuu aau ga ggc  aguaagug gu  g gucaucuuuau  g
   uguuuc        -u    c     gg          uc      cu  -      -u    c   a  g   gu        u  aa u           ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC002990.685: 6834-7040 [+]
intergenic
Database links

Mature sequence mdm-miR319e

Accession MIMAT0043567
Sequence

22 - 

gagcuuucuucaguccacuc

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).