Stem-loop sequence mdm-MIR166j

AccessionMI0035600 (change log)
DescriptionMalus domestica miR166j stem-loop
Literature search

7 open access papers mention mdm-MIR166j
(35 sentences)

Stem-loop
   --auayauuacaaa      uuaucguu            uu       a     cuaauaa 
5'               ggaagc        uugaggggaaug  gucuggu cgagg       g
                 ||||||        ||||||||||||  ||||||| |||||       u
3'               ccuucg        aacuccccuuac  cggacca gcucc       c
   aaccguuuaaucua      ---uaauc            uu       g     uuaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC006517.413: 15753-15874 [+]
intergenic
Database links

Mature sequence mdm-miR166j

Accession MIMAT0043545
Sequence

73 - 

ucggaccaggcuucauucccc

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).