Stem-loop sequence mdm-MIR159e

AccessionMI0035595 (change log)
DescriptionMalus domestica miR159e stem-loop
Literature search

11 open access papers mention mdm-MIR159e
(68 sentences)

Stem-loop
   auauauauguau u   -     -uua   a            ga             -----   a   u     g  ag    g     c    g uc   g  u     a      --au      ga  ag 
5'             g ggg uaggg    agg guggagcuccuu  aguccaaaagaag     gug ugc gggug au  agcu cugag uaug a  cca ag ccuau uauccu    aucgca  uc  a
               | ||| |||||    ||| ||||||||||||  |||||||||||||     ||| ||| ||||| ||  |||| ||||| |||| |  ||| || ||||| ||||||    ||||||  ||   
3'             c cuc gucuc    ucc caucucgaggga  uuagguuuuuuuc     cgc aug uccau ua  ucga gacuc auac u  ggu uu ggaua guagga    uagcgu  ag  u
   ---ucucucucu u   u     ucuc   a            ag             uccgu   -   -     -  cg    g     u    g uc   g  c     -      agac      --  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011193.361: 3986-4239 [-]
intergenic
Database links

Mature sequence mdm-miR159e

Accession MIMAT0043540
Sequence

205 - 

uuuggauugaagggagcucua

 - 225

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).