Stem-loop sequence mdm-MIR159d

AccessionMI0035594 (change log)
DescriptionMalus domestica miR159d stem-loop
Literature search

11 open access papers mention mdm-MIR159d
(67 sentences)

Stem-loop
   gguua   au           ga              uuau  ---      g  ag    g     c    g uc      ua     u     --au   a    ag 
5'      agg  uggagcuccuu  aguccaaaagaagg    gc   ugggug au  agcu uugag uaug a  ccacag  cuauu auccu    guu gauc  a
        |||  |||||||||||  ||||||||||||||    ||   |||||| ||  |||| ||||| |||| |  ||||||  ||||| |||||    ||| ||||   
3'      ucc  aucucgaggga  uuagguuuuuuucu    cg   guccau ua  ucga gacuc auac u  gguguu  gauag uaggg    cag cuag  u
   -gcuc   ac           ag              ccgu  cau      -  cg    g     u    g uc      gg     -     aagc   -    gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001900.112: 17252-17462 [+]
intergenic
Database links

Mature sequence mdm-miR159d

Accession MIMAT0043539
Sequence

182 - 

uuuggauugaagggagcucua

 - 202

Get sequence
Evidence experimental; Illumina [1]

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).