Stem-loop sequence abu-mir-210

AccessionMI0033990 (change log)
DescriptionAstatotilapia burtoni miR-210 stem-loop
Stem-loop
   --    a   acua       u  -u  cag 
5'   agcc cug    acgcaca ug  gc   u
     |||| |||    ||||||| ||  ||   u
3'   ucgg gac    ugcgugu ac  ug   u
   aa    c   agug       c  cu  acc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AstBur1.0; GCA_000239415.1) Overlapping transcripts
JH425678.1: 622378-622439 [-]
intergenic
Database links

Mature sequence abu-miR-210

Accession MIMAT0042256
Sequence

1 - 

agccacugacuaacgcacauug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25186727 "The genomic substrate for adaptive radiation in African cichlid fish" Brawand D, Wagner CE, Li YI, Malinsky M, Keller I, Fan S, Simakov O, Ng AY, Lim ZW, Bezault E, Turner-Maier J, Johnson J, Alcazar R, Noh HJ, Russell P, Aken B, Alfoldi J, Amemiya C, Azzouzi N, Baroiller JF, Barloy-Hubler F, Berlin A, Bloomquist R, Carleto Nature. 513:375-381(2014).