Stem-loop sequence sly-MIR171f

AccessionMI0033712 (change log)
DescriptionSolanum lycopersicum miR171f stem-loop
Literature search

22 open access papers mention sly-MIR171f
(129 sentences)

Stem-loop
   --ucu         c       c     -cacau    uu 
5'      gauauuggc ugguuca ucaga      auua  u
        ||||||||| ||||||| |||||      ||||  u
3'      cuauaacug gccgagu aguuu      uagu  g
   ugacu         u       u     ucauuu    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr2: 33343990-33344069 [-]
intergenic
Database links

Mature sequence sly-miR171f

Accession MIMAT0042038
Sequence

6 - 

uauuggccugguucacucaga

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1