Stem-loop sequence sly-MIR399b

AccessionMI0033690 (change log)
DescriptionSolanum lycopersicum miR399b stem-loop
Literature search

1 open access papers mention sly-MIR399b
(2 sentences)

Stem-loop
   --         ua      a     a  -  a   ua 
5'   ugauagggc  cucucu uuggc ug ca uug  u
     |||||||||  |||||| ||||| || || |||  a
3'   auugucccg  gagagg aaccg ac gu gac  u
   uc         uc      a     c  a  c   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr3: 3816894-3816967 [-]
intergenic
chr3: 3820945-3821018 [-]
intergenic
chr3: 3825271-3825344 [-]
intergenic
Database links

Mature sequence sly-miR399b

Accession MIMAT0042016
Sequence

6 - 

gggcuacucucuauuggcaug

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1