Stem-loop sequence sly-MIR398a

AccessionMI0033688 (change log)
DescriptionSolanum lycopersicum miR398a stem-loop
Literature search

14 open access papers mention sly-MIR398a
(50 sentences)

Stem-loop
   --ca      u                  au  g       --uguuu    c 
5'     auaggg ugauuugagaacauaugu  gu cauauuu       guaa a
       |||||| ||||||||||||||||||  || |||||||       ||||  
3'     uguccc gcuggacucuuguauaca  ca guauaaa       cauu a
   caga      c                  --  -       uauuugc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr11: 50299414-50299514 [-]
intergenic
Database links

Mature sequence sly-miR398a

Accession MIMAT0042014
Sequence

76 - 

uauguucucaggucgccccug

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1