Stem-loop sequence sly-MIR393

AccessionMI0033686 (change log)
DescriptionSolanum lycopersicum miR393 stem-loop
Literature search

18 open access papers mention sly-MIR393
(88 sentences)

Stem-loop
   --auu     a            u        -      aauua 
5'      auucc aagggaucgcau gauccugu guucca     a
        ||||| |||||||||||| |||||||| ||||||     u
3'      uaagg uucucuagcgua cuagggua cagggu     u
   ccucu     c            -        u      accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr3: 3081745-3081831 [+]
intergenic
Database links

Mature sequence sly-miR393

Accession MIMAT0042012
Sequence

62 - 

aucaugcgaucucuucggaau

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1