Stem-loop sequence sly-MIR827

AccessionMI0033684 (change log)
DescriptionSolanum lycopersicum miR827 stem-loop
Literature search

5 open access papers mention sly-MIR827
(12 sentences)

Stem-loop
   --auu            g       u   ucauaucauu       guuuu  g 
5'      uguuuguugaug ucaucua uca          uggcaua     ug a
        |||||||||||| ||||||| |||          |||||||     ||  
3'      acaaacaacuac aguagau agu          accguau     ac a
   cuucu            a       u   ----------       -aauu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 65453531-65453627 [+]
intergenic
Database links

Mature sequence sly-miR827

Accession MIMAT0042010
Sequence

72 - 

uuagaugaacaucaacaaaca

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1