Stem-loop sequence sfr-mir-285

AccessionMI0033651 (change log)
DescriptionSpodoptera frugiperda miR-285 stem-loop
Stem-loop
        c       ca    u         a   ga     uug 
5' gucca aauuuga  acug auucgagug gug  uagag   u
   ||||| |||||||  |||| ||||||||| |||  |||||    
3' caggu uuaagcu  ugac uaagcuuac cac  aucuc   g
        -       cg    u         -   -g     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02001518.1: 98591-98675 [+]
intergenic
Database links

Mature sequence sfr-miR-285-5p

Accession MIMAT0041965
Sequence

16 - 

acuguauucgagugaguggaua

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-285-3p

Accession MIMAT0041966
Sequence

52 - 

uagcaccauucgaauucagugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).