Stem-loop sequence sfr-mir-11

AccessionMI0033601 (change log)
DescriptionSpodoptera frugiperda miR-11 stem-loop
Stem-loop
    ug     u         c             cc    ugu 
5' g  cgguc cguggcuag acuuuggcuguga  ugug   c
   |  ||||| ||||||||| |||||||||||||  ||||   g
3' u  gucgg gcaucgauc ugagacugacacu  acac   u
    gu     c         u             --    uga 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02011046.1: 2067-2149 [-]
intergenic
Database links

Mature sequence sfr-miR-11-5p

Accession MIMAT0041880
Sequence

15 - 

cuagcacuuuggcugugaccu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-11-3p

Accession MIMAT0041881
Sequence

50 - 

caucacagucagaguucuagcu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).