Stem-loop sequence gma-MIR399n

AccessionMI0033500 (change log)
DescriptionGlycine max miR399n stem-loop
Literature search

14 open access papers mention gma-MIR399n
(86 sentences)

Stem-loop
   g    u             ug               aaugg        ---uu    ua    a ag 
5'  caaa cauucauagggca  ucucuuuuggcaggu     ugauuacu     ggau  auuu g  c
    |||| |||||||||||||  |||||||||||||||     ||||||||     ||||  |||| |   
3'  guuu gugagugucccgu  agaggaaaccguuca     acuaauga     ucug  uaaa c  u
   -    -             cg               -----        uauau    ua    a ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 36109955-36110082 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399n
gma-MIR399nchr16: 36109955-36110082 [+]
gma-MIR399bchr16: 36115809-36115909 [+]
Database links

Mature sequence gma-miR399n

Accession MIMAT0041708
Sequence

98 - 

ugccaaaggagagcugcccug

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1