Stem-loop sequence gma-MIR4414b

AccessionMI0033480 (change log)
DescriptionGlycine max miR4414b stem-loop
Literature search

1 open access papers mention gma-MIR4414b
(1 sentences)

Stem-loop
   --     g  ga  --         acu     g   ac       u   ag   uc      aagaucgaucgaugaugucgg 
5'   aggcg ug  ag  auggcugaa   cagcu cug  ucguugg ucg  agc  accauu                     c
     ||||| ||  ||  |||||||||   ||||| |||  ||||||| |||  |||  ||||||                     a
3'   ucugc ac  uc  ugcugauuu   gucga ggc  agcaacc agu  ucg  uggugg                     c
   gu     -  ug  ag         -ac     g   gu       u   cu   uc      aauuaauacauguacccgacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR4414b

Accession MIMAT0041688
Sequence

26 - 

agcugcugacucguugguucg

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1