Stem-loop sequence gma-MIR169w

AccessionMI0033468 (change log)
DescriptionGlycine max miR169w stem-loop
Literature search

23 open access papers mention gma-MIR169w
(96 sentences)

Stem-loop
   g     a     -               cauu     -  -u          ag    u 
5'  gaaug agcca aggaugacuugccgg    aauuu gc  augaagcuag  agua a
    ||||| ||||| |||||||||||||||    ||||| ||  ||||||||||  ||||  
3'  uuuac ucggu uccuauuggacggcc    uugag cg  uacuucgauc  uuau g
   g     a     g               --uu     u  uu          ga    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 5348169-5348283 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169w
gma-MIR169cchr9: 5343659-5343773 [+]
gma-MIR169wchr9: 5348169-5348283 [+]
Database links

Mature sequence gma-miR169w

Accession MIMAT0041676
Sequence

11 - 

caaggaugacuugccggcauu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1