Stem-loop sequence gma-MIR4405b

AccessionMI0033454 (change log)
DescriptionGlycine max miR4405b stem-loop
Literature search

1 open access papers mention gma-MIR4405b
(1 sentences)

Stem-loop
   ccacccuaaaaca       a         au          a  uu  -   -----------     aa     uuc 
5'              uucuaag cgguuguuc  aaccgccuua aa  ug cgu           uguaa  aucaa   u
                ||||||| |||||||||  |||||||||| ||  || |||           |||||  |||||   c
3'              aagauuc gccaauaag  uugguggaau uu  ac gcg           acauu  uaguu   a
   aaaugcugcgcua       a         cc          a  uc  u   ccaccguuuga     aa     ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 22567095-22567243 [+]
intergenic
Database links

Mature sequence gma-miR4405b

Accession MIMAT0041662
Sequence

116 - 

uuccgaauaaccgacuuagaaauc

 - 139

Get sequence
Evidence experimental; Illumina [1]

References

1