Stem-loop sequence gma-MIR167l

AccessionMI0033446 (change log)
DescriptionGlycine max miR167l stem-loop
Literature search

26 open access papers mention gma-MIR167l
(184 sentences)

Stem-loop
   a     aa     a    --c             cuuu      ---ag   ugaa 
5'  aggaa  aguga gcug   cagcaugaucuag    gguuag     agc    g
    |||||  ||||| ||||   |||||||||||||    ||||||     |||    a
3'  uccuu  ucacu cgac   gucguacuggauc    ccaauc     uug    a
   a     cc     c    aau             auuc      guaaa   ugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 37301792-37301901 [+]
intergenic
Database links

Mature sequence gma-miR167l

Accession MIMAT0041654
Sequence

11 - 

ugaagcugccagcaugaucu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1