Stem-loop sequence gma-MIR4348d

AccessionMI0033432 (change log)
DescriptionGlycine max miR4348d stem-loop
Literature search

1 open access papers mention gma-MIR4348d
(1 sentences)

Stem-loop
   ac       a a         u   g             u    uaa      -acaac     g       g          -     cuc        ag                              u     u aua      a  a    ga   gcaa 
5'   caaugua g caauucacc gca cgaaagcucacuc caug   ggguug      aaugu auggaaa uagugguuaa uuaaa   aagauaau  aagacuaugugucaaacuugcaagaugaua uauua g   guugga gc uuca  aua    g
     ||||||| | ||||||||| ||| ||||||||||||| ||||   ||||||      ||||| ||||||| |||||||||| |||||   ||||||||  |||||||||||||||||||||||||||||| ||||| |   |||||| || ||||  |||     
3'   guuacau c guuaagugg ugu gcuuucgagugag gugu   cucaau      uuacg uaucuuu aucaucaguu gauuu   uuuuauua  uuuugauacauaguuugaauguucuacuau auaau c   caaccu ug gagu  uau    a
   uc       c c         c   g             u    --g      aaacca     g       a          u     ---        cu                              u     c --a      a  a    -g   aacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 6848789-6849112 [+]
intergenic
Database links

Mature sequence gma-miR4348d

Accession MIMAT0041640
Sequence

294 - 

uuucggugucggugaauugcc

 - 314

Get sequence
Evidence experimental; Illumina [1]

References

1