Stem-loop sequence dme-mir-10404

AccessionMI0033427 (change log)
DescriptionDrosophila melanogaster miR-10404 stem-loop
Stem-loop
   auaca             -    -u        gu 
5'      uuuauugaaggaa uuga  auaugcca  a
        ||||||||||||| ||||  ||||||||   
3'      aaauaacuuucuu aauu  uauguggu  a
   -acaa             u    uu        aa 
Get sequence
Deep sequencing
57167 reads, 792 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 23205159-23205227 [+]
intergenic
chrX: 23291450-23291518 [+]
intergenic
chrX: 23538215-23538283 [-]
intergenic
CP007120.1: 46106-46174 [+]
intergenic
CP007120.1: 70290-70358 [+]
intergenic
DS484101.1: 1497-1565 [+]
intergenic
DS485228.1: 386-454 [-]
intergenic
DS485453.1: 1017-1085 [+]
intergenic
DS485826.1: 824-892 [-]
intergenic
DS485968.1: 127-195 [+]
intergenic
Database links

Mature sequence dme-miR-10404-5p

Accession MIMAT0041637
Sequence

8 - 

uauugaaggaauugauauaugc

 - 29

Get sequence
Deep sequencing53248 reads, 49 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-10404-3p

Accession MIMAT0041638
Sequence

41 - 

uguauuuuuaauuucuuucaau

 - 62

Get sequence
Deep sequencing3688 reads, 48 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25605965 "A deeply conserved, noncanonical miRNA hosted by ribosomal DNA" Chak LL, Mohammed J, Lai EC, Tucker-Kellogg G, Okamura K RNA. 21:375-384(2015).