Stem-loop sequence hsa-mir-10396b

AccessionMI0033426 (change log)
DescriptionHomo sapiens miR-10396b stem-loop
Stem-loop
   ---   -  -        a   g   u 
5'    cgg cg gggcucgg gcc ggc u
      ||| || |||||||| ||| |||  
3'    gcc gc cccgggcc cgg ccg c
   cag   a  u        c   g   g 
Get sequence
Deep sequencing
1391 reads, 0 reads per million, 108 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 8436324-8436374 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-10396b
hsa-mir-10401chr21: 8206563-8206618 [+]
hsa-mir-10401chr21: 8250772-8250827 [+]
hsa-mir-10401chr21: 8389610-8389665 [+]
hsa-mir-6724-4chr21: 8432530-8432621 [+]
hsa-mir-10401chr21: 8433797-8433852 [+]
hsa-mir-10396bchr21: 8436324-8436374 [+]
Database links

Mature sequence hsa-miR-10396b-5p

Accession MIMAT0041635
Sequence

1 - 

cggcggggcucggagccggg

 - 20

Get sequence
Deep sequencing522 reads, 85 experiments
Evidence experimental; Illumina [1]

Mature sequence hsa-miR-10396b-3p

Accession MIMAT0041636
Sequence

30 - 

ggccccgggcccucgaccggac

 - 51

Get sequence
Deep sequencing574 reads, 76 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25723320 "Comprehensive miRNA sequence analysis reveals survival differences in diffuse large B-cell lymphoma patients" Lim EL, Trinh DL, Scott DW, Chu A, Krzywinski M, Zhao Y, Robertson AG, Mungall AJ, Schein J, Boyle M, Mottok A, Ennishi D, Johnson NA, Steidl C, Connors JM, Morin RD, Gascoyne RD, Marra MA Genome Biol. 16:18(2015).