Stem-loop sequence hsa-mir-10401

AccessionMI0033425 (change log)
DescriptionHomo sapiens miR-10401 stem-loop
Stem-loop
   ---  u      a    ug    g   a c 
5'    cg guggga ggcg  gggu cgg c c
      || |||||| ||||  |||| ||| |  
3'    gc cgcccu ccgc  ucca gcc g c
   gcc  c      g    --    -   c g 
Get sequence
Deep sequencing
1325 reads, 156 reads per million, 144 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 8206563-8206618 [+]
intergenic
chr21: 8250772-8250827 [+]
intergenic
chr21: 8389610-8389665 [+]
intergenic
chr21: 8433797-8433852 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-10401
hsa-mir-6724-1chr21: 8205315-8205406 [+]
hsa-mir-10401chr21: 8206563-8206618 [+]
hsa-mir-3648-1chr21: 8208473-8208652 [+]
hsa-mir-10401chr21: 8250772-8250827 [+]
hsa-mir-10401chr21: 8389610-8389665 [+]
hsa-mir-10401chr21: 8433797-8433852 [+]
Database links

Mature sequence hsa-miR-10401-5p

Accession MIMAT0041633
Sequence

1 - 

cgugugggaaggcguggggu

 - 20

Get sequence
Deep sequencing118 reads, 53 experiments
Evidence experimental; Illumina [1]

Mature sequence hsa-miR-10401-3p

Accession MIMAT0041634
Sequence

36 - 

accucgccgucccgcccgccg

 - 56

Get sequence
Deep sequencing933 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25723320 "Comprehensive miRNA sequence analysis reveals survival differences in diffuse large B-cell lymphoma patients" Lim EL, Trinh DL, Scott DW, Chu A, Krzywinski M, Zhao Y, Robertson AG, Mungall AJ, Schein J, Boyle M, Mottok A, Ennishi D, Johnson NA, Steidl C, Connors JM, Morin RD, Gascoyne RD, Marra MA Genome Biol. 16:18(2015).