Stem-loop sequence hsa-mir-10395

AccessionMI0033419 (change log)
DescriptionHomo sapiens miR-10395 stem-loop
Stem-loop
   ---gu     --a   ca   -     gga  acu 
5'      gaugg   gag  aua cccgg   ug   g
        |||||   |||  ||| |||||   ||    
3'      cuguc   cuu  ugu ggguu   ac   u
   guagu     aug   -a   a     -ac  cag 
Get sequence
Deep sequencing
1303 reads, 0.971 reads per million, 103 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 12703601-12703664 [-]
intergenic
Database links

Mature sequence hsa-miR-10395-5p

Accession MIMAT0041621
Sequence

1 - 

gugauggagagcaauacc

 - 18

Get sequence
Deep sequencing33 reads, 21 experiments
Evidence experimental; Illumina [1]

Mature sequence hsa-miR-10395-3p

Accession MIMAT0041622
Sequence

44 - 

auguauucguacugucugaug

 - 64

Get sequence
Deep sequencing1075 reads, 87 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25723320 "Comprehensive miRNA sequence analysis reveals survival differences in diffuse large B-cell lymphoma patients" Lim EL, Trinh DL, Scott DW, Chu A, Krzywinski M, Zhao Y, Robertson AG, Mungall AJ, Schein J, Boyle M, Mottok A, Ennishi D, Johnson NA, Steidl C, Connors JM, Morin RD, Gascoyne RD, Marra MA Genome Biol. 16:18(2015).