Stem-loop sequence ssc-mir-4331-2

AccessionMI0033415 (change log)
DescriptionSus scrofa miR-4331-2 stem-loop
Literature search

2 open access papers mention ssc-mir-4331-2
(44 sentences)

Stem-loop
        -    g  g       a      uuggau 
5' agcug uggc ua aucacag cacagc      c
   ||||| |||| || ||||||| ||||||       
3' ucgac accg au ugguguc gugucg      u
        g    g  g       g      uugugg 
Get sequence
Deep sequencing
136 reads, 1.11e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 144183485-144183553 [+]
intergenic
Database links

Mature sequence ssc-miR-4331-5p

Accession MIMAT0037379
Sequence

6 - 

uggcguagaucacagacacagc

 - 27

Get sequence
Deep sequencing96 reads, 12 experiments
Evidence experimental; Illumina [3]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).