Stem-loop sequence ssc-mir-660

AccessionMI0033413 (change log)
DescriptionSus scrofa miR-660 stem-loop
Literature search

2 open access papers mention ssc-mir-660
(3 sentences)

Stem-loop
       -cauac    u      c    u   gaau 
5' cucc      ccau gcauau ggag ugu    u
   ||||      |||| |||||| |||| |||    c
3' gagg      ggua cgugua ccuc acg    u
       acauuu    -      u    c   aaac 
Get sequence
Deep sequencing
1679 reads, 267 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 48640821-48640889 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-660
ssc-mir-532chrX: 48632025-48632104 [+]
ssc-mir-500chrX: 48637994-48638073 [+]
ssc-mir-362chrX: 48638466-48638544 [+]
ssc-mir-660chrX: 48640821-48640889 [+]
Database links

Mature sequence ssc-miR-660

Accession MIMAT0041612
Sequence

7 - 

uacccauugcauaucggaguug

 - 28

Get sequence
Deep sequencing1678 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).