Stem-loop sequence ssc-mir-454

AccessionMI0033410 (change log)
DescriptionSus scrofa miR-454 stem-loop
Literature search

1 open access papers mention ssc-mir-454
(1 sentences)

Stem-loop
       -g      a          gg    ggu 
5' agua  ugcaau uugcuuauag  uuuu   g
   ||||  |||||| ||||||||||  ||||   u
3' ucau  acguug aacggguauc  gaag   u
       ag      -          aa    ggu 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 37088130-37088194 [+]
intergenic
Database links

Mature sequence ssc-miR-454

Accession MIMAT0041609
Sequence

3 - 

uagugcaauauugcuuauagggu

 - 25

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).