Stem-loop sequence ssc-mir-375

AccessionMI0033409 (change log)
DescriptionSus scrofa miR-375 stem-loop
Literature search

6 open access papers mention ssc-mir-375
(8 sentences)

Stem-loop
       c   c    a      ccu  c     c  gac 
5' cccc gcc cgcg cgagcc   cg acaaa cg   c
   |||| ||| |||| ||||||   || ||||| ||    
3' gggg cgg gugc gcucgg   gc uguuu gc   u
       a   a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
239 reads, 9.09 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 133957549-133957623 [+]
intergenic
Database links

Mature sequence ssc-miR-375

Accession MIMAT0041608
Sequence

46 - 

uuuguucguucggcucgcguga

 - 67

Get sequence
Deep sequencing239 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).