Stem-loop sequence ssc-mir-200b

AccessionMI0033407 (change log)
DescriptionSus scrofa miR-200b stem-loop
Literature search

7 open access papers mention ssc-mir-200b
(34 sentences)

Stem-loop
      c    -    ug     c      u  ug 
5' ccg cauc uuac  ggcag auugga gg  u
   ||| |||| ||||  ||||| |||||| ||  c
3' ggc guag aaug  ccguc uaaucu cu  u
      a    u    gu     a      -  gg 
Get sequence
Deep sequencing
385 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 58064306-58064370 [+]
intergenic
Database links

Mature sequence ssc-miR-200b

Accession MIMAT0041606
Sequence

41 - 

uaauacugccugguaaugaugac

 - 63

Get sequence
Deep sequencing378 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).