Stem-loop sequence ssc-mir-141

AccessionMI0033406 (change log)
DescriptionSus scrofa miR-141 stem-loop
Literature search

6 open access papers mention ssc-mir-141
(7 sentences)

Stem-loop
          --    c        -   ugg  ua 
5' ccaucuu  ccag acaguguu gga   uc  a
   |||||||  |||| |||||||| |||   ||  u
3' gguagaa  gguc ugucacaa ccu   ag  a
          au    -        u   cga  ug 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 66193719-66193783 [-]
intergenic
Database links

Mature sequence ssc-miR-141

Accession MIMAT0041605
Sequence

44 - 

uaacacugucugguaaagaug

 - 64

Get sequence
Deep sequencing101 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).