Stem-loop sequence ssc-mir-330

AccessionMI0033402 (change log)
DescriptionSus scrofa miR-330 stem-loop
Stem-loop
              --    -    u   ag    ugcaa 
5' cugccucucug  ggcc ugug cuu  gcuc     g
   |||||||||||  |||| |||| |||  ||||     a
3' gacggagagac  ccgg acac gaa  cgag     u
              gu    c    -   -a    ccaac 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf4186: 17724-17795 [-]
intergenic
Database links

Mature sequence ssc-miR-330

Accession MIMAT0041601
Sequence

6 - 

ucucugggccugugucuuaggcu

 - 28

Get sequence
Deep sequencing26 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).