Stem-loop sequence ssc-mir-10387

AccessionMI0033400 (change log)
DescriptionSus scrofa miR-10387 stem-loop
Stem-loop
       aua   cuc       g   ---caag   aa    acaaa 
5' ccug   gag   cuggaag ccu       uuc  ccuc     g
   ||||   |||   ||||||| |||       |||  ||||      
3' ggac   cuc   gaccuuc gga       aag  ggag     a
       guc   cac       g   ccaccua   ac    ccccc 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 123036512-123036600 [+]
intergenic
Database links

Mature sequence ssc-miR-10387

Accession MIMAT0041599
Sequence

2 - 

cugauagagcuccuggaaggccu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).