Stem-loop sequence ssc-mir-26b

Accession

MI0033397 (change log)

Description

Sus scrofa miR-26b stem-loop

Literature search

12 open access papers mention ssc-mir-26b
(19 sentences)

Stem-loop

      -   u        uc           u ug 
5' ccc agu caaguaau  aggauagguug g  c
   ||| ||| ||||||||  ||||||||||| |   
3' ggg ucg guucauua  ucuuguccgac c  u
      c   -        cc           - ug 

Deep sequencing

21940 reads, 4.04e+03 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chrUScaf756: 56015-56079 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0033397

Mature sequence ssc-miR-26b-5p

• Accession: MIMAT0041595
• Sequence: 6 - uucaaguaauucaggauagguu - 27
• Deep sequencing: 21900 reads, 15 experiments
• Evidence: experimental; Illumina [1]

Mature sequence ssc-miR-26b-3p

• Accession: MIMAT0041596
• Sequence: 41 - ccuguucuccauuacuuggcu - 61
• Deep sequencing: 38 reads, 10 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).