Stem-loop sequence ssc-mir-26b

AccessionMI0033397 (change log)
DescriptionSus scrofa miR-26b stem-loop
Literature search

12 open access papers mention ssc-mir-26b
(19 sentences)

Stem-loop
      -   u        uc           u ug 
5' ccc agu caaguaau  aggauagguug g  c
   ||| ||| ||||||||  ||||||||||| |   
3' ggg ucg guucauua  ucuuguccgac c  u
      c   -        cc           - ug 
Get sequence
Deep sequencing
21940 reads, 4.04e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf756: 56015-56079 [+]
intergenic
Database links

Mature sequence ssc-miR-26b-5p

Accession MIMAT0041595
Sequence

6 - 

uucaaguaauucaggauagguu

 - 27

Get sequence
Deep sequencing21900 reads, 15 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-26b-3p

Accession MIMAT0041596
Sequence

41 - 

ccuguucuccauuacuuggcu

 - 61

Get sequence
Deep sequencing38 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).