Stem-loop sequence ssc-mir-1388

AccessionMI0033392 (change log)
DescriptionSus scrofa miR-1388 stem-loop
Literature search

1 open access papers mention ssc-mir-1388
(1 sentences)

Stem-loop
    ug    ca  a   u  a        auggugagc 
5' g  ccuc  gg cug ca accugaga         g
   |  ||||  || ||| || ||||||||         u
3' c  ggag  cc gac gu uggacucu         c
    gu    ag  c   u  g        aacagggac 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf4148: 37165-37239 [-]
intergenic
Database links

Mature sequence ssc-miR-1388

Accession MIMAT0041590
Sequence

9 - 

aggacugucaaaccugagaaug

 - 30

Get sequence
Deep sequencing18 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).