Stem-loop sequence ssc-mir-10382

AccessionMI0033391 (change log)
DescriptionSus scrofa miR-10382 stem-loop
Stem-loop
              -a   a        ca      aga 
5' aggugaguagg  cgg ggucaggg  aggggu   g
   |||||||||||  ||| ||||||||  ||||||   g
3' uccgcucaucc  guc ccgguccc  ucucca   c
              ca   c        ag      agu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 121669991-121670064 [+]
intergenic
Database links

Mature sequence ssc-miR-10382

Accession MIMAT0041589
Sequence

45 - 

ucugacccuggccccugacccu

 - 66

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).