Stem-loop sequence aga-mir-286b

AccessionMI0033377 (change log)
DescriptionAnopheles gambiae miR-286b stem-loop
Literature search

2 open access papers mention aga-mir-286b
(2 sentences)

Stem-loop
   ----    a   -   ag        ---   g uu 
5'     gcga ugu cgg  uagucgcu   ugu a  g
       |||| ||| |||  ||||||||   ||| |   
3'     ugcu aca gcc  aucaguga   aca u  a
   ccua    c   a   ag        aaa   g ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 3537482-3537547 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-286b
aga-mir-286bchr2L: 3537482-3537547 [-]
aga-mir-2944a-2chr2L: 3537080-3537136 [-]
Database links

Mature sequence aga-miR-286b-5p

Accession MIMAT0041566
Sequence

1 - 

gcgaaugucggaguagucgcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-286b-3p

Accession MIMAT0041567
Sequence

43 - 

ugacuagaccgaacacucguaucc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).