Stem-loop sequence aga-mir-285

AccessionMI0033350 (change log)
DescriptionAnopheles gambiae miR-285 stem-loop
Literature search

2 open access papers mention aga-mir-285
(2 sentences)

Stem-loop
   --    gc   cu  c      ua     cau 
5'   acug  uuc  au ggugcu  gaugg   a
     ||||  |||  || ||||||  |||||   u
3'   ugac  aag  ua ccacga  uugcu   g
   ca    ua   cu  -      uc     aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3L: 39242666-39242729 [+]
intergenic
Database links

Mature sequence aga-miR-285-5p

Accession MIMAT0041519
Sequence

1 - 

acuggcuuccuaucggugcuuaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-285-3p

Accession MIMAT0041520
Sequence

43 - 

uagcaccauucgaaaucaguac

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).