Stem-loop sequence aga-mir-2944b

AccessionMI0033339 (change log)
DescriptionAnopheles gambiae miR-2944b stem-loop
Literature search

5 open access papers mention aga-mir-2944b
(16 sentences)

Stem-loop
   ga   -    c   g         --u   a 
5'   agg aacu ccg ugugauaug   ugg a
     ||| |||| ||| |||||||||   ||| a
3'   ucc uuga ggc acacuauac   gcc a
   -g   a    u   g         cau   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 43009067-43009127 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2944b
aga-mir-286chr3R: 43009395-43009490 [-]
aga-mir-2944bchr3R: 43009067-43009127 [-]
aga-mir-2944a-1chr3R: 43008879-43008934 [-]
aga-mir-309chr3R: 43008711-43008784 [-]
Database links

Mature sequence aga-miR-2944b-5p

Accession MIMAT0041507
Sequence

1 - 

gaaggaacucccggugugauaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-2944b-3p

Accession MIMAT0041508
Sequence

41 - 

uaucacagcgguaguuaccug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).