Stem-loop sequence aga-mir-2944a-1

AccessionMI0033336 (change log)
DescriptionAnopheles gambiae miR-2944a-1 stem-loop
Literature search

3 open access papers mention aga-mir-2944a-1
(14 sentences)

Stem-loop
   -g    a  uu          c   gu 
5'   aagg ac  cugcugugau uga  u
     |||| ||  |||||||||| |||  a
3'   uuuc ug  gaugacacua acu  g
   aa    a  uu          u   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 43008879-43008934 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2944a-1
aga-mir-286chr3R: 43009395-43009490 [-]
aga-mir-2944bchr3R: 43009067-43009127 [-]
aga-mir-2944a-1chr3R: 43008879-43008934 [-]
aga-mir-309chr3R: 43008711-43008784 [-]
Database links

Mature sequence aga-miR-2944a-5p

Accession MIMAT0041503
Sequence

1 - 

gaaggaacuucugcugugaucu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-2944a-3p

Accession MIMAT0041504
Sequence

35 - 

uaucacaguaguuguacuuuaa

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).