Stem-loop sequence cgr-mir-29b-2

AccessionMI0033073 (change log)
DescriptionCricetulus griseus miR-29b-2 stem-loop
Stem-loop
   --          c      g  u    uuuucc 
5'   gcugguuuca auggug cu agau      a
     |||||||||| |||||| || ||||       
3'   ugacuaaagu uaccac ga ucua      u
   ug          u      -  -    uguuuc 
Get sequence
Deep sequencing
59717 reads, 517 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH002029.1: 102547-102610 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-29b-2
cgr-mir-29b-2JH002029.1: 102547-102610 [+]
cgr-mir-29cJH002029.1: 103082-103157 [+]
Database links

Mature sequence cgr-miR-29b

Accession MIMAT0041144
Sequence

1 - 

gcugguuucacaugguggcuuaga

 - 24

Get sequence
Deep sequencing11127 reads, 6 experiments
Evidence not experimental

References

1
PMID:25689160 "Annotation of additional evolutionary conserved microRNAs in CHO cells from updated genomic data" Diendorfer AB, Hackl M, Klanert G, Jadhav V, Reithofer M, Stiefel F, Hesse F, Grillari J, Borth N Biotechnol Bioeng. 112:1488-1493(2015).